DNA-O-Gram Generator.

DNA (deoxyribonucleic acid) is the primary genetic material in all living organisms. A molecule composed of two complementary strands that are wound around each other in a double helix formation. The strands are connected by base pairs that look like rungs in a ladder.
Now, you can send a message that will be encoded as DNA and you will be given the option to email the encoded message. The message will be accompanied by instructions on how to decode the message.

Here's a message from me to you:

ACGGTACTTCTTGTTGATGGAGACGTCATGGAAG
TAGGCGCTATGCCAGAGCTTATGACGCTTGGACT
TGTACGTGTTGGCGTAATGAACGCGGGCGACGTG

In order to see what it reads you have to go to the 'DNA-O-Gram Generator' site and click on 'Decode a DNA-o-gram.'

[ DNA-O-Gram Generator ]