Egyptian Name Generator.

Want to know what your name looks like in Egyptian hieroglyphics?
The Generator's name looks like this:



[ Egyptian Name Generator ]

Rock Star Name Generator.

Whether you like it heavy or hard, gothic or classic, it all falls under one label: Rock. From past 8 Tracks of Led Zeppelin to MP3s of Linkin Park today, the one constant in music has been Rock and Roll. What better way to front your garage band than a first class stage name? Use the Rock Star Name Generator to create your unique music rockstar name based on your real name.

The Generator's Rock Star Name is: Van Rush.

[ Rock Star Name Generator ]

Random Person Generator.

The Random Person Generator makes a new person.
Different every time.
The Generator made this person:



[ Random Person Generator ]

Pack Place Sign Generator.

Generate your own Pack Place Sign.



[ Pack Place Sign Generator ]

Color Scheme Generator.

While designing web pages, computer applications, or house interiors, we need to find a good color scheme. For every tint there are colors which it can coexist with, and which it can't. Some combinations are uncomfortable, or disturbing - while others are pleasant.

This application generates color schemes of several types. Every scheme is based on one base color, which is supplemented with additional colors making together the best optical impression.

[ Color Scheme Generator ]

Here's [ another ] one.

Buzzword Generator.

Some buzzwords:

forceful incremental capability,
nonstationary strict time-phase,
accelerated anolog concept.

[ Buzzword Generator ]

Spammer Name Generator.

If you're an up-and-coming generic V1agra salesman, you've got to have the right name. Nobody would buy penile superpower drugs from a salesman who openly cited a PhD, or spoke on behalf of an established pharmaceutical company; the public demands random nouns and middle initials, and will settle for nothing less.

The Generator's Spammer Name is: Chapman R. Royalty.

[ Spammer Name Generator [

Goth Lyric Generator.

Create your own Goth Lyrics.

Serpents cling to blackened brilliance
Prayers swell with yearning rapture
Fire eviscerates beloved minions
Agony engulfs feral concubine

[ Goth Lyric Generator ]

Computer Programmers Nickname Generator.

Need and easy way to generate nicknames for the computer programmers in your office? This Computer Programmers Nickname Generator uses a simple javascript routine to generate a random nickname from an array based on the content of your real name.

The Generator is not a Computer Programmer, but if he were, his nickname would be" The Gangster of Code.

[ Computer Programmers Nickname Generator ]

Rap Star Name Generator.

Whether you like the old school hip-hop of 'Rapper's Delight' by the Sugarhill Gang, or the 'gangsta' rap of 50 Cent, one theme plays out: great hip-hop rap star names. Even if you think Ja Rule is 'Ja Crap' or Old Dirty Bastard lacks finesse, an urban styled hip hop name is fun for the whole family.

The Generator's Rap Star Name is The Rhyme .

[ Rap Star Name Generator ]

Lorem Ipsum Generator.

Another 'Lorem Ipsum Generator,' but a very comprehensive one. You can choose between various languages and charsets like, Arabic, Chinese, Greek, Hindi, Cyrillic, L33tspeak, Esperanto, Interlingua, Slovio, Sona, Japanese and more.

Here's a 'Lorem Ipsum' in Lëtzebuergesch, the language spoken in Luxemburg.

Räich ugedon schéinen an zwé. Vun eise Biereg duurch si, hin jo Wisen Poufank, drem gudden bessert dé méi. Wa gin Hunn Blieder. Hir eise jéngt heescht op, mir no Heck d'Pan d'Vioule.

[ Lorem Ipsum Generator ]

Fridge Message Generator.

Create your own fridge magnet messages.



[ Fridge Message Generator ]

Here's [ another ] one

Text To Speech Generator.

Enter some text, choose a voice, then click the 'speak' button.
Your text will be spoken in UK English, US English, Spanish, German and French.

[ Text To Speech Generator ]

Magical Name Acronym Generator.

Nothing is more important to
a person than their name. It is
a label we are given at birth and
therefore can affect our personality
as we grow up and become individuals.

This generator will take your real name
or blog/journal username and tell you
what each letter of it means about
your personality. The things you
learn about yourself or others
in this test may be important!

[ Magical Name Acronym Generator ]

Nerd Name Generator.

Cast off your mundane name and get a new nerd name.

The Generator's nerd name is: Nigel, the Debian Luser.

[ Nerd Name Generator ]

Ransom Note Generator.

Warning: this is for entertainment purposes only. Do not use it for any illegal activities. The Generator Blog will cooperate with all valid law enforcement requests.

Enter your ransom note text in the box. When done, click 'Generate Ransom Note' and a printable ransom note will be created for you.

[ Ransom Note Generator ]

Spam-O-Matic Generator.

Create your own spam.

DO YOU FEEL UNHAPPY? N0 MORE! those times are over.
GET INSTANT HAPPINESS 100%!!!!
Did you ever think..... it doesnt w0rk!? Now it does!
Read on--GENERATOR2000(TM) this will help you GUARANTEED

Try it for free NOW! JUST $89... too good to be troo?
I thought s0 too ....at first. Try it now. CLICK HERE
www.buy-generator2000.com

[ Spam-O-Matic Generator ]

Associate Degrees of Kevin Bacon Generator.

The 'Six Degrees of Kevin Bacon' is fun. No argument there. The problem, though, is that the game is limited to the tiny but growing fraction of people who have been in one or more major motion pictures. What about the rest of humanity? What game is there for them?

This one. In this game, we can connect anyone, anywhere to Kevin Bacon. Just enter a name and find out how that person fits into the Bacon-oriented world.

The Generator taught 'Da Bump' to Suzette Dibny,
who can't stop thinking about Leonard Fortuitous,
who can't get enough of Betty Hopper,
who who once sang a karaoke version
of 'Islands in the Stream' with Kevin Bacon

[ Associate Degrees of Kevin Bacon Generator ]

Star Wars Title Generator.

Help Mr. Lucas out by suggesting old-school titles for the next Star Wars episode, courtesy of randomness.

Coming to a theatre near you:
Die, Obi-Wan, Die.

[ Star Wars Title Generator ]

George W. Bush Conspiracy Generator.

Want to come up with your own conspiracy theory about George W. Bush? Don't let Al Franken, Michael Moore, and MoveOn.org have all the fun! Use this handy George W. Bush Conspiracy Theory Generator to come up with your own conspiracy theory!

* This tool may not be used to create Democratic presidential candidate speeches!

George W. Bush had Michael Jackson arrested so that Rush Limbaugh and Ann Coulter could upset The French.

[ George W. Bush Conspiracy Generator ]

Elvish Name Generator.

No, not Elvis, Elvish.
You have a secret Elvish name.
Discover it.

The Generator's Elvish name is: Mablung Míriel.

[ Elvish Name Generator ]

Letter Generator.

Here you can learn the parts of a letter and how to write your own letter. Just enter your name and get started...

[ Letter Generator ]

Band Name Generator.

There are a lot of Band Name Generators out there.
This is another one but it also generates a poster.



[ Band Name Generator ]

Word Generator.

Stuck for a word? Need something to adequately describe your day yet doesn't already have some other meaning? Look no further than the random word generator!

By analysing the frequency of pairs of letters in 45,402 different words it is possible to generate new words which don't have any meaning but are reasonably syntactically correct.

The Generator made these new words:

generatoraspocketamentingly, generatorist, generatortiveolem, generatoranswimps, generatorusabety, generatornylonian, generatorbiconjunimatessie

[ Word Generator ]

Insulting Nickname Generator.

The Generator already had a nickname. People call him 'Weirdo.'
But now he has an insulting nickname too.



[ Insulting Nickname Generator ]

Bush Background Generator.

Enter some text and create a Bush Background.



[ Bush Background Generator ]

Star Wars Name Generator.

Find out your Star Wars name.

The Generator's Star Wars name is:
Thege Ligen, Rothonda of None

[ Star Wars Name Generator ]

Gif to Text Generator.

This script takes the URL of a GIF image and converts that GIF image into ASCII text or colored HTML. Not very useful, but pretty cool.

[ Gif to Text Generator ]

Bar Joke Generator.

Exhausted your repertiore of bar jokes? Tired of combing local brewpubs and traffic schools for fresh material?
That's why the Random Bar Joke Generator was created. Each press of the button will deliver another knee-slapper, guaranteed to be hilarious to anyone who's sufficiently sloshed out of their gumboots to not actually be that discriminating.

So this guy walks into a bar. A pig gets close to the guy and says 'Give me a dollar and I'll recite the Carmina Burana from memory.' The guy says 'I'm not a guy, I'm a bum!' The bartender thinks a minute and says 'You owe me ten bucks.'

Um... I don't think I get it.

[ Bar Joke Generator ]

Indian Name Generator.

Just enter some information and hit the button. After the wheels stop spinning you will be presented with a certificate that confirms your new Authentic Indian Name.



[ Indian Name Generator ]

Embedded Media HTML Generator.

You may have viewed web pages that have movies or animations that display within a portion of a web page rather than in a separate application. Animation, audio, video, or other media that is displayed within a web page is known as embedded media.

The Embedded Media HTML Generator has been developed to ease the burden of inserting video and animations into web pages.

[ Embedded Media HTML Generator ]

Astronomical Brainabetizer Generator.

Create your name or that of your website with the help of a Brain Alphabet.



Also available, an Astronomical Alphabet



a Sign Alphabet



[ Astronomical Brainabetizer Generator ]

Cocktail Generator.

With the scienterrific Mixilator, creating a cocktail is as easy as pressing a button. You can let the Mixilator do it all, or, to keep things interesting, you can make personal selections to influence your otherwise random automatic cocktail.

The Generator created this cocktail:

Poole's Foppery Special.
Chill cocktail glass. Prepare as follows:
In cocktail shaker frappe with ice
* 1½ oz Seagram's V.O.
* 1 oz Plymouth gin
* ¾ oz grape juice
* 1 tsp. Malort
* 5 drops Underberg bitters

Pour into cocktail glass. Float a scant spoonful of dark rum on surface of drink.

[ Cocktail Generator ]

Concept Web Generator.

Fill in some information and make your own concept web.

[ Concept Web Generator ]

Proverbs Generator.

Create random proverbs.
Like this one:



[ Proverbs Generator ]

Worksheet Generator.

Now you can create customized worksheets in less than 5 minutes! Choose from several vocabulary and math worksheet templates.

[ Worksheet Generator ]

Professor Poopypants Name Change Generator.

Let Professor Poopypants change your name into a silly one.



The Generator's silly name is: Falafel Lizardbuns.

[ Professor Poopypants Name Change Generator ]

Bushku Generator.

It's Bushku, poppie! A Bushku is a Haiku, cyberpoetry as from the glib lips of the US President. A Bushku uses a 3-5-3 syllable form, 'cause 5-7-5 is too darn complexicated.

dry duh scrubs
small clean vile hopes sing
brave (Help me, Dick!) eels shine

[ Bushku Generator ]

Country Star Name Generator.

It has many styles and genres. Contemporary, Honky-Tonk, Bluegrass, Western, Outlaw, Cowboy, even Progressive. But you probably know and love it as Country music. Whether you gamble on Kenny Rogers or get the blues with Alan Jackson, a great western stage name fits like a great pair of well-worn jeans. Use the Country Star Name Generator to let the redneck in you show.

The Generator's Country Star Name is: Vern Pitts.

[ Country Star Name Generator ]

Fairy Tale Generator.

Create your own Fairy Tale.
The Generator created this one:

I stepped outside with father's boots on, feeling the heaviness of his feet in mine. The people in my country's soil then clawed into his boots and pulled me down until I could no longer breathe in anything but dense thick soil and earthworm particles traveling into my mouth.

The spirits of my land traveled through me as well. They drifted in and out of my body, trading places and laughing, laughing at me and my sad predicament.

[ Fairy Tale Generator ]

Snoop Dogg Shizzolator.

What up, cuz? It's tha Snoopy D-O-double Gizzle in da hizzle. Enter yo trickass url and traaanslate it from tha shizzle to da shiznit, know what I'm sayin?

Take a look at The Generator Blog in shiznit.

[ Snoop Dogg Shizzolator ]

Glitter and Glam Rock Name Generator.

If you've ever dreamed of being Ziggy Stardust or a member of Vixen or Poison, this is for you! Just enter your gender and find out your new Glam Rock Star Name.

The Generator's Glitter and Glam Rock Name is: Jupiter Lippstikk.

[ Glitter and Glam Rock Name Generator ]

AIEEE Generator.

Are you tired of practicing your blank stares for when someone says they need a TCP/IP-based LAN set up and a USB-to-SCSI adapter ASAP? Do you wish you could throw around acronyms with that same casual attitude that pisses you off so much? Here's your chance.

With the Acronym Interaction, Expansion and Extrapolation Engine, you can enter any combination of letters you like and you'll get a handy, technical-sounding, completely made-up phrase that borders on the plausible.

Weblog = Wide Erasable Boolean Line Option Graphics.

[ AIEEE Generator ]

Dossier Sexupifier Generator.

Enter the text of your weak, unconvincing dossier, and have it automatically sexed up in seconds, in just the way that Alistair Campbell wouldn't have done.

The Generator Blog is clearly not about those machines used to change mechanical energy into electrical energy within 45 minutes. It's about software that creates software. Software to play around and have fun with.

[ Dossier Sexupifier Generator ]

Gas Giant Image Generator.

The Gas Giant Image Generator creates images of...um, gas giants.
A gas giant is a large planet that is not composed mostly of rock or other solid matter. Gas giants may still have a rocky or metallic core, but the majority of its mass is in the form of gas.



[ Gas Giant Image Generator ]

Business Proposal Generator.

Ever wondered where all those Nigerian Scam emails you keep getting are coming from? Well, they're not coming from here, I can tell you that. But using the Business Proposal Generator, you can come up with your own, including some combinations that even these con men never imagined.

Dear Sir,
My name is Chuichui Todescu, and I am the Cousin of Mr. Chuichui C., the recently Deceased Chairman of the National Bank in Nigeria. If you have been following the events in my country over the last few years, you will remember the big scandal that took place when Mr. C. was found dead in an alley, from an alledged overdose of Tylenol Flu.

As your name was brought to my attention by a very trusted contact in Nigeria's Foreign Office, I have been authorized by my partners to contact you with this Proposal. All that would be required of you is the use of your bank account to perform a transfer of TEN MILLION ($10000000) U.S. Dollars. I am authorized by my Cousin's estate in Nigeria to offer you TWO MILLION FIVE HUNDRED THOUSAND DOLLARS ($2500000) as a compensation for your services.

[ Business Proposal Generator ]

Mr. T Name Generator.

No web trend is complete without involvement by Mr. T, so provide some information and start talking like a hella strong badass.

The Generator's Mr. T Name is: Fool.

[ Mr. T Name Generator ]

Bridge Hand Generator.

The playBridge Hand Generator is a bridge training and education tool. Use one of three available generator screens and playBridge will shuffle and deal for you.
Use it to practice bidding with your partner, to visualize hands, to resolve what-if situations or to produce pre-filled duplicate forms.

[ Bridge Hand Generator ]

Candy Hearts Generator.

To celebrate Valentine's Day, here's another Candy Hearts Generator.



[ Candy Hearts Generator ]

Cyborg Name Generator.

A cyborg, short for CYBernetic ORGanism, is a human being whose body has been taken over in whole or in part by electromechanical devices.

The Generator is a General Electronic Nocturnal Exploration Replicant/Android Trained for Observation and Repair.



[ Cyborg Name Generator ]

(via Corpus Mmothra)

Brad Pitt Consolation Letter Generator.

Brad Pitt is very sad right now and needs the support of his fans while he goes through his difficult and very public breakup with Jennifer Aniston. Write a consolation letter to good old Bradley and try to heal his pain.

[ The Brad Pitt Consolation Letter Generator ]

Jennifer Aniston Consolation Letter Generator.

Jennifer Aniston is very sad right now and needs the support of her fans while she goes through her difficult and very public breakup with Brad Pitt. Write a consolation letter to this recently single hottie good old Jen and try to heal her pain.

[ The Jennifer Aniston Consolation Letter Generator ]

Name Meaning Generator.

Names. Many of us have them, yet what do they mean?
The Royal Academy of Everything has prepared a complete scientific-linguistic analysis of every name ever. Just fill in a small profile to learn about your name.

Literal meaning of Generator: Acetylcolinase.
History: Celebrated as the first word written with the first pencil invented exactly three hundred years ago next week, the name Generator was originally used to refer to a breed of goose.
Famous Generators:
Generator Toot, who could never shake an early association with the concept of acceptable losses;
Generator Tightbadger, channeller under supernatural influences of the lost consonant of Atlantis;
Generator d'Oaf, ghost-writer of Ming the Merciless's excessively sophisticated autobiography;
Typical Generator motto: 'Some bloke over there said it'd be all right.'

[ Name Meaning Generator ]

Comic Strip Generator.

Here's another Comic Strip Creator.



[ Comic Strip Generator ]

Pirate Speak Generator.

Aye ye scurvy dogs, e'er wanted t' be a pirate? Talk with a deep 'oice, have your usual pedestrian walk replaced by a seaman's swagger? Then it is time you learn t' talk like a pirate.

The Pirate Speak Generator will turn your normal small talk int' that o' a bloodthirsty picaroon. Gar, where can I find a bottle o'rum?

[ Pirate Speak Generator ]

(via Christopher)

Dungeon Generator.

Create your own Dungeons and Dragons random dungeon.
The Generator created this dungeon:



[ Dungeon Generator ]

ESL Idea Generator.

The ESL Idea Generator helps ESL teachers explore new ways of teaching. It consists of a randomly generated list of ideas, activities, and suggestions for teaching. Most are fairly simple and can be used with a minimum of preparation.
If the first idea doesn't suit your needs, try again and maybe you'll find something perfect for today's class.

The ESL Idea Generator suggested this idea:

Inquire to see if your students have any unusual talents (can wiggle their ears, can bark like a dog), and encourage them to demonstrate.

[ ESL Idea Generator ]

(via Catnip & Catnaps)

Text Generator.

Tired of using Lorem Ipsum for dummy text in your latest masterpiece? This text generator has been developed based on years of careful research and is guaranteed to improve even the most lacklustre of designs.

Thunder, thunder, thundercats, Ho! Thundercats are on the move, Thundercats are loose. Feel the magic, hear the roar, Thundercats are loose. Thunder, thunder, thunder, Thundercats! Thunder, thunder, thunder, Thundercats! Thunder, thunder, thunder, Thundercats! Thunder, thunder, thunder, Thundercats! Thundercats!

[ Text Generator ]

Keyword Email Signature Generator.

Do you want to annoy those at Echelon (you know, the organization that watches your every move) with some suspicious words in your email signature?
This generator uses a combination of 1662 words to create random signatures for some gagging fun.

I just send an email and signed like this:

Yours Truly, The Generator. Agencies AIMSX argus bank Broadside Centro Chan DC6 detcord DSNET1 DynCorp E911 Enemy of the St FAS Field Security FSB gchq.gov.uk illuminati incendiary devi IRAN ISCS JAVA JRSC KY-75 lamma MOSSAD MP40 NAIAG NASA niche NSWT P415 PLO r00t RPC SAS SC Shipiro unclassified Uzi

Have to go now, someone's knocking on the door!

[ Keyword Email Signature Generator ]

(via Tommi)

Famous Star Generator.

Get your own star on the walk of fame in Hollywood.



[ Famous Star Generator ]

(via Justin)

DNA-O-Gram Generator.

DNA (deoxyribonucleic acid) is the primary genetic material in all living organisms. A molecule composed of two complementary strands that are wound around each other in a double helix formation. The strands are connected by base pairs that look like rungs in a ladder.
Now, you can send a message that will be encoded as DNA and you will be given the option to email the encoded message. The message will be accompanied by instructions on how to decode the message.

Here's a message from me to you:

ACGGTACTTCTTGTTGATGGAGACGTCATGGAAG
TAGGCGCTATGCCAGAGCTTATGACGCTTGGACT
TGTACGTGTTGGCGTAATGAACGCGGGCGACGTG

In order to see what it reads you have to go to the 'DNA-O-Gram Generator' site and click on 'Decode a DNA-o-gram.'

[ DNA-O-Gram Generator ]

Magic: The Gathering Card Generator.

Ever wonder how the fine folks at Wizards of the Coast come up with all those new cards? Well here's a little peek behind the scenes at one of the tools they use. This little program generates names, casting costs, and rarities for Magic cards. It sometimes comes up with silly names, which is strange, considering that it only uses words from existing cards.



[ Magic: The Gathering Card Generator ]

Transparent PNG Generator.

The Transparent PNG Generator is a web application where you can easily create transparent PNG images. These can be used to create cool effects in a variety of ways. This application produces only rectangular images, so it will be used mostly for web page background images, but use it for whatever you like.



[ Transparent PNG Generator ]

Dr. Phil Quote Generator.

During these times of trouble and turmoil, nothing sedates a soul or stifles common sense quite like words of wisdom from Dr. Phil. In order to preserve his legacy and allow 24-hour a day access to the wit and wisdom of the Sage of our generation, The Random Dr. Phil Quote Generator will satisfy your 'inner wuss.'

This is what Dr. Phil told The Generator:

You don't need sideburns to act real sassy-like.
You don't need anyone or anything to let me tell you how to live.
You don't need a lesson in astrophysics to wax your elbows.

[ Dr. Phil Quote Generator ]

Color Palette Generator.

You can use this php script to generate a color palette based on an image. You may upload an image, or choose one from the list. If you upload an image, it will be kept on the server and can be used again.

A color palette was created based on this chimp's image:



[ Color Palette Generator ]

Frog Generator.

There are all kind of frogs.
There are big frogs, dwarf frogs, tree frogs, poisonous frogs, you name it.
But did you know there are also Random Frogs?

Don't believe me?
Use The Frog Generator and it'll show you a Random Frog.

It showed me this funny fellow:



He looks almost like me!

[ Frog Generator ]

British Movie Titles Generator.

Type in a word and get your own British Movie Title.



[ British Movie Titles Generator ]

Label Generator.

Make your own label.



[ Label Generator ]

Barcode Generator.

Generate a printable and scannable barcode in Interleaved 2 of 5, Code 39, Code 128 A, B, or C symbologies.



[ Barcode Generator ]

Drink-O-Meter Generator.

Have you ever wondered just quite how much you've managed yo drink in your lifetime? Or how much it might have cost you? With the Drink-O-Meter you can test the state of your kidneys, wallet and quantity of alcohol you have consumed over the years.

The Drink-O-Meter says The Generator has consumed 1936 drinks. The amount of money spent was $7746. With this result 5.66 bath tubs could be filled and I could buy 0.04 Ferrari's.
Hm, strange, since the Generator doesn't consume any alcohol at all.

[ Drink-O-Meter Generator ]

Hogwarts House Generator.

Forget all that zodiac stuff. If you've ever read any of the Harry Potter books, you'll know that the true evaluation of your character is which of the houses at Hogwarts Academy you belong to.



The Generator belongs to the House of Gryffindor.

[ Hogwarts House Generator ]

Michael Jackson Mug Shot Generator.

Poor Michael Jackson. Everbody's making fun of him. Well, not everybody. The Generator doesn't.
The Generator loves Michael Jackson.



[ Michael Jackson Mug Shot Generator ]

Monster Pitch Generator.

Ever seen a trailer for a new horror movie and thought 'Damn, I could come up with something better than that.' Here's your chance to create the ultimate horror movie. Then sit back and enjoy your very own movie pitch!

The Generator created this movie plot:

Pjotr Iscary stars as Seagull Man, half seagull, half man. When Professor Kitsy Bungess (Luanna Ghastly) accidentally created seagull man in her laboratory in the sleepy little town of Oppression, California, she shunted his romantic advances.
That hurt Seagull Man, and he has vowed revenge on Kitsy, Oppression, and all of humanity! As Seagull Man attempts to make the Earth a man-free zone, only Professor Bungess and her partially blind great uncle Roger (Heinz Furchterregend) can stop him! Feel the excitement! Witness the brutality! Fear the birds! Don't miss 'The Revenge of Seagull Man,' your life may never be the same!

[ Monster Pitch Generator ]